View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3909_high_20 (Length: 206)

Name: NF3909_high_20
Description: NF3909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3909_high_20
NF3909_high_20
[»] chr7 (1 HSPs)
chr7 (24-191)||(8176235-8176408)
[»] chr6 (1 HSPs)
chr6 (57-93)||(11748480-11748516)


Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 24 - 191
Target Start/End: Complemental strand, 8176408 - 8176235
Alignment:
24 tgatgtgggttgaggcccattccgaaacaattgccccaagcccttattgtctttatgacataagaagcttcagaaggagacaaccttgataacaacttat 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
8176408 tgatgtgggttgaggcccattccgaaacaattgccccaagcccttattgtctttatgacataagaagcttcagaaggagacaagcttgataacaacttat 8176309  T
124 gactttgggcagagaatagttgagacatgtgcacctccgtcttt------atgatgcgttttgatattcctttg 191  Q
    |||||||||||||| |||||||||| | |||||||||||| |||      ||||||||||||||||||||||||    
8176308 gactttgggcagagcatagttgagaaaagtgcacctccgtgtttatggagatgatgcgttttgatattcctttg 8176235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 93
Target Start/End: Original strand, 11748480 - 11748516
Alignment:
57 ccccaagcccttattgtctttatgacataagaagctt 93  Q
    |||||||||||||| ||||||||||| ||||||||||    
11748480 ccccaagcccttatcgtctttatgacgtaagaagctt 11748516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University