View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3909_low_13 (Length: 309)
Name: NF3909_low_13
Description: NF3909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3909_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 19 - 301
Target Start/End: Complemental strand, 25049479 - 25049195
Alignment:
| Q |
19 |
taatcgtcatggaatggatgaagagggtaatttaaagggatatggataaagaatgaggttagaaaagattgtgctggcaatttcattacattacatatag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25049479 |
taatcgtcatggaatggatgaagagggtaatttaaagggatatggataaagaatgaggttagaaaagattgtgctggcaatttcattacattacatatag |
25049380 |
T |
 |
| Q |
119 |
ccggcttaggaatggttgcttctggccgtctgtgaaaccggctctcatgttatgagnnnnnnncttctttcttcctttgtcttttactcacaa--ttgtg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25049379 |
ccggcttaggaatggttgcttctggccgtctgtgaaaccggctctcatgttatgagtttttttcttctttcttcctttgtcttttactcacaattttgtg |
25049280 |
T |
 |
| Q |
217 |
ttatgtggctttcaaccggttttggaatctgtttgatgtatctgtgactctcttattatataacttcattcaccttttcctctgt |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25049279 |
ttatgtggctttcaaccggttttggaatctgtttgatgtatctgtgactctcttattatataacttcattcaccttttcctctgt |
25049195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University