View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3909_low_23 (Length: 206)
Name: NF3909_low_23
Description: NF3909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3909_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 24 - 191
Target Start/End: Complemental strand, 8176408 - 8176235
Alignment:
| Q |
24 |
tgatgtgggttgaggcccattccgaaacaattgccccaagcccttattgtctttatgacataagaagcttcagaaggagacaaccttgataacaacttat |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8176408 |
tgatgtgggttgaggcccattccgaaacaattgccccaagcccttattgtctttatgacataagaagcttcagaaggagacaagcttgataacaacttat |
8176309 |
T |
 |
| Q |
124 |
gactttgggcagagaatagttgagacatgtgcacctccgtcttt------atgatgcgttttgatattcctttg |
191 |
Q |
| |
|
|||||||||||||| |||||||||| | |||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
8176308 |
gactttgggcagagcatagttgagaaaagtgcacctccgtgtttatggagatgatgcgttttgatattcctttg |
8176235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 93
Target Start/End: Original strand, 11748480 - 11748516
Alignment:
| Q |
57 |
ccccaagcccttattgtctttatgacataagaagctt |
93 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
11748480 |
ccccaagcccttatcgtctttatgacgtaagaagctt |
11748516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University