View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3910_high_5 (Length: 381)
Name: NF3910_high_5
Description: NF3910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3910_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 213 - 372
Target Start/End: Original strand, 36836403 - 36836557
Alignment:
| Q |
213 |
gagcaaggatttgtcaatttcaatcattttgtaaatgtgttgattcatgatatgctatcgcaaatatcaatgtacttggtaaggggtcgtaaatattgat |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
36836403 |
gagcaaggatttgtcaatttcaatcattttgtaaatgtgttgattcatgatatgctatcgcaaatatcaatgtactt-gtaaggggtcg----tattgat |
36836497 |
T |
|
| Q |
313 |
attgggatttgtttgctaatattagaaaattataaattgtaaccacatggttgatgatgt |
372 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36836498 |
attgggatttgtttgctgatattagaaaattataaattgtaaccgcatggttgatgatgt |
36836557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University