View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3910_low_14 (Length: 209)
Name: NF3910_low_14
Description: NF3910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3910_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 50 - 166
Target Start/End: Original strand, 42061004 - 42061120
Alignment:
| Q |
50 |
ttctgatctaataggttaccgatcgaactaccatcaacattaactcaatatgtagagcgatgaataaaaatttacgacaaggcttgtctacatatcatat |
149 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
42061004 |
ttctgatctactaggttacctatcgaactaccatcaacattaattcaatatgtagagcgatgaataaaaatttatgacgaggcttgtctacatatcatat |
42061103 |
T |
|
| Q |
150 |
atttcatattttcttgt |
166 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42061104 |
atttcatattttcttgt |
42061120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 13 - 44
Target Start/End: Original strand, 42060898 - 42060929
Alignment:
| Q |
13 |
cagagagtgaaggagaataagacaatccagga |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42060898 |
cagagagtgaaggagaataagacaatccagga |
42060929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University