View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3910_low_5 (Length: 414)
Name: NF3910_low_5
Description: NF3910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3910_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 9 - 398
Target Start/End: Complemental strand, 25576540 - 25576151
Alignment:
| Q |
9 |
agcacagaagaagtcatctgttgttaattttatttcatgtccttccggaagttcaaggccacttttactcagaaccatgcacatttcctctatagatatg |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
25576540 |
agcaccgaagaagtcatctgttgttaattttatttcatgtccttccggaagttcaaggccacttttattcagaaccatgcacatttcctctgtagatatg |
25576441 |
T |
 |
| Q |
109 |
atggttgaacagccagaacggggagtaatatgagtttccagagttggcttctgaacttcagttggaatatcatccgccatcagtgttctaggatgctgaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25576440 |
atggttgaacagccagaacggggagtaatatgagtttccagagttggcttctgaacttcagttggaatatcatccgccatcagtgttctaggatgctgaa |
25576341 |
T |
 |
| Q |
209 |
agcccacttcccattttacccttctgggagacaatttctctgcaataactggtttggttaaattcttattattgtcctcctgcacgtgttggtcctttac |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25576340 |
agcccacttcccattttacccttctgggagacaatttctctgcaataactggtttggttaaattctcattattgtcctcctgcacgtgttggtcctttag |
25576241 |
T |
 |
| Q |
309 |
cgtggcatccaccgctgtagtggacactacagcttgtccatttacagcaatatctgagtccttggtttgtaaattctccaattccattgt |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25576240 |
cgtggcatccaccgctgtagtggacactacagcttgtccatttacagcaatatctgagtccttggattgtaaattctccaattccattgt |
25576151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University