View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3913_high_37 (Length: 271)
Name: NF3913_high_37
Description: NF3913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3913_high_37 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 13 - 271
Target Start/End: Original strand, 44801214 - 44801472
Alignment:
| Q |
13 |
accaccaccaaagtattaaatgaggggttgtacctcttggcttcaacctagaagtggactaaggaggtgcaacaaatatgatcaggtgcacattgtgtcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44801214 |
accaccaccaaagtattaaatgaggggttgtacctcttggcttcaacctagaagtggactaaggaggtgcaacaaatatgatcaggtggacattgtgtcc |
44801313 |
T |
|
| Q |
113 |
attgaataatgacatgtaataattttgtgagtgagagctatactgtgaagtagtaataagatgtttgtgggacaaagaagaaggtgacgatcgatagaca |
212 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44801314 |
attgaacaatgacatgtaataattttgtgagtgagagctatactgtgaggtagtaataagatgtttgtgggacaaagaagaaggtgacgatcgatagaca |
44801413 |
T |
|
| Q |
213 |
agtctatgaatatggaagaaggagctgaaggggcgacacagatgaaagttagggtttct |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44801414 |
agtctatgaatatggaagaaggagctgaaggggcgacacagatgaaagttagggtttct |
44801472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University