View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3913_high_38 (Length: 265)
Name: NF3913_high_38
Description: NF3913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3913_high_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 51 - 252
Target Start/End: Complemental strand, 38771035 - 38770834
Alignment:
| Q |
51 |
tgtggtggttcctccggctgaggagaaagtgattgaagtggttttaacaaaagcagaatctgtggataacaaagtagtggaagcaacatctagcatagaa |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38771035 |
tgtggtggttcctccggctgaggagaaagtgattgaagtggttttaacaaatgcagaatctgtggataacaaagtagtggaagcaacatctagcatagaa |
38770936 |
T |
|
| Q |
151 |
gatatatccaaggcttctgatgttggttggcagcagtgataaagcttccatctcttaatccaaccggctgcaccgtgtagctgcaaagtcgtcgtctgtg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38770935 |
gatatatccaaggcttctgatgttggttggcagcagtgataaagcttccatctcttgatccaaccggctgcaccgtgtagctgcaaagtcgtcgtctgtg |
38770836 |
T |
|
| Q |
251 |
ct |
252 |
Q |
| |
|
|| |
|
|
| T |
38770835 |
ct |
38770834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University