View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3913_high_47 (Length: 227)
Name: NF3913_high_47
Description: NF3913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3913_high_47 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 51547515 - 51547295
Alignment:
| Q |
7 |
gccagtaatgacagtgagatcccttccatcaccaagtagaacaatattggttttattgcttgaaatttcaacattttcctcatatatcccttcttttaca |
106 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51547515 |
gccagtaatgacagtttgatcccttccatcaccaagtagaacaatattggttttattgcttgaaatttcaacattttcctcatatatcccttcttttaca |
51547416 |
T |
|
| Q |
107 |
tagattattatcctagcatagctgttatttggagcaaattcaatggcttcattaatggtgctaaagtttcccgttccatctgcagccacaacaatcacat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51547415 |
tagattattatcctagcatagctgttatttggagcaaattcaatggcttcattaatggtgctaaagtttcccgttccatctgcagccacaacaatcacat |
51547316 |
T |
|
| Q |
207 |
tgtcggtgctttgcaagaacc |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
51547315 |
tgtcggtgctttgcaagaacc |
51547295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 8 - 191
Target Start/End: Complemental strand, 19475406 - 19475223
Alignment:
| Q |
8 |
ccagtaatgacagtgagatcccttccatcaccaagtagaacaatattggttttattgcttgaaatttcaacattttcctcatatatcccttcttttacat |
107 |
Q |
| |
|
||||| |||||||| ||| |||||||||||||| | ||||| || ||||||| |||| |||||||||||||| ||||| ||||||||| |||| |
|
|
| T |
19475406 |
ccagtgatgacagtagaatcacttccatcaccaagcatcacaatgttagttttataacttggtatttcaacattttcatcataatacccttctttaacat |
19475307 |
T |
|
| Q |
108 |
agattattatcctagcatagctgttatttggagcaaattcaatggcttcattaatggtgctaaagtttcccgttccatctgcag |
191 |
Q |
| |
|
| || | ||||||| | | || |||||||||||||| | || || |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
19475306 |
aaataactatcctaaccaaactattatttggagcaaagtttatagcatcattaatagtgctaaagtttccacttccatctgcag |
19475223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University