View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3913_high_54 (Length: 216)
Name: NF3913_high_54
Description: NF3913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3913_high_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 12 - 201
Target Start/End: Original strand, 2116321 - 2116510
Alignment:
| Q |
12 |
agcacagattcatagcttggattttagtatctgagtctttcttcaatgattcacaccaatagcagttgcacacacaaactggtactcatgctgtatgatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2116321 |
agcacagattcatagcttggattttagtatctgagtctttcttcaatgattcacaccaatagcacttgcacacacaaactggtactcatgctgtatgatt |
2116420 |
T |
 |
| Q |
112 |
gaattgatgaacttcagcttctagatttggttatgctatatgctaatatctgtgatggnnnnnnnncataaattaatgaatatataaaat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2116421 |
gaattgatgaacttcagcttctagatttggttatgctatatgctaatatctgtgatggaaaaaaaacataaattaatgaatatataaaat |
2116510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University