View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3913_low_14 (Length: 413)
Name: NF3913_low_14
Description: NF3913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3913_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 370; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 5 - 401
Target Start/End: Complemental strand, 5697590 - 5697193
Alignment:
| Q |
5 |
gagatttgcaactggaaaacatattataaactccttgggatagcaaaaatcgttgagtgggttgaaataggggaaatgagagaaattatggattgctctt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5697590 |
gagatttgcaactggaaaacatattataaactccttgggatagcaaaaatcgttgagtgggttgaattaggggaaatgagagaaattatggattgctctt |
5697491 |
T |
 |
| Q |
105 |
gataaacaattgaggataatttattggttaatttttgtaactctcttgttcttgatataaaaggttagggtggaaattagggtttgcttatgttgatctc |
204 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5697490 |
ggtaaacaattgaggataatttattggttaatttttgtaactctcttgttcttgatataaaaggttagggtggaaattagggtttgcttatgttgatctc |
5697391 |
T |
 |
| Q |
205 |
atttatggatccgataattgctctctccgtaggcaatttgggttgaactgcgaaaacaatttttgtctgttttttccttctactctatttatcttctcta |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5697390 |
atttatggatccgataattgctctctccgtaggcaatttgggttgaactgcgaaaacaatctttgtctgttttttccttctactctatttatcctctcta |
5697291 |
T |
 |
| Q |
305 |
ttctttgaattgcttctttggatttacatcacacataggttctaaatttgttttggattttatctattgttgaagt-ttttaattgtagttgtcattg |
401 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5697290 |
ttctttgaattgcttctttggatttacatcacacataggttctaaatttgttttggattgtatctattgttgaagttttttaattgtagttgtcattg |
5697193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University