View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3913_low_30 (Length: 319)
Name: NF3913_low_30
Description: NF3913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3913_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 18 - 308
Target Start/End: Complemental strand, 11401774 - 11401484
Alignment:
| Q |
18 |
ttatataggctagctttccttacataatgaataaacctaatcactaagatataatgaagagacggttcagatattttaataaagatagtcttgcatgtaa |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
11401774 |
ttatataggctaggtttccttacataatgaataaacctaatcactaagatataatgaagaggcgtttcagataatttaataaagatagtcttgcatgtaa |
11401675 |
T |
 |
| Q |
118 |
gcaagatacatgcttgatggctaagtttcttacaagtaaagataaaacaaacggtgctccttatcttcaagtggtccagtagtatcatcatttcttaatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11401674 |
gcaagatacatgcttgatggctaagtttcttacaagtaaagataaaacaaacggtgctccttatcttcaagtggtccagtagtatcatcatttcttaatg |
11401575 |
T |
 |
| Q |
218 |
gtgaagacttgtcttctagaatgcttctaaaatcttctagtttatgcttgatttaattttcttacagttgtcatttgtcattgttgatatt |
308 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
11401574 |
gtgaagacttgtcttctggaatgcttctaaaatcttctagtttatgcttgatttaattttcttacggttgtcatttgtcattgtttatatt |
11401484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University