View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3913_low_35 (Length: 288)
Name: NF3913_low_35
Description: NF3913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3913_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 17 - 281
Target Start/End: Original strand, 409399 - 409663
Alignment:
| Q |
17 |
acaacgttgtttctgttaacgatgacaaagaaaaaccaacgatcttggtctccgagaaactcggagaagcagggctacaagtgttaagacaattaggaca |
116 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
409399 |
acaacgttgtttctgttaacgatgaaaatgaaaaaccaacgatcttggtctccgagaaactaggagaagcagggctacaagtgttaagacaattaggaaa |
409498 |
T |
|
| Q |
117 |
tgtggaatgtgcttatgatctttcaccagaagacctatgcaagaagatctcaagctgtgatgctttgattgtgagaagcggtacgaaagttacaaggcaa |
216 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
409499 |
tgtggaatgtgcatatgatctttcaccagaagacctatgcaagaagatctcaagctgtgatgctttgattgtgagaagcggtacgaaagttacaaggaaa |
409598 |
T |
|
| Q |
217 |
gtgtttgaagcaggaaaaggaaagttgaaagttgttggtagagctggtgttgggattgatgatgt |
281 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
409599 |
gtgtttgaagcagggaaaggaaagttgaaagttgttggtagagctggtgttgggattgataatgt |
409663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University