View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3913_low_45 (Length: 232)
Name: NF3913_low_45
Description: NF3913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3913_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 38550062 - 38549857
Alignment:
| Q |
19 |
attgaaggtcttcttgggcactggagagcaaatttgttggtgagatgagcatcttgctcttttttatcacacaannnnnnn----acatgtttatttgaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38550062 |
attgaaggtcttcttgggcactggagagcaaatttgttggtgagacgagcatcttgctcttttttatcacacaatttgtttttttacatgtttatttgaa |
38549963 |
T |
 |
| Q |
115 |
ctttgaagttcttttatcatacatacatacacacatgttgatatttgaagttttttaagttctttttatcacacaattgctcttttctgtccctcggttc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38549962 |
ctttgaagttcttttatcatacatacatacacacatgttgatatttgaagttttttaagttctttttatcacacaattgctcttttctgtccctcggttg |
38549863 |
T |
 |
| Q |
215 |
atctca |
220 |
Q |
| |
|
|||||| |
|
|
| T |
38549862 |
atctca |
38549857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University