View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3913_low_50 (Length: 225)
Name: NF3913_low_50
Description: NF3913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3913_low_50 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 225
Target Start/End: Original strand, 47136002 - 47136220
Alignment:
| Q |
7 |
gaaacggcaaaaacagttctggaattccaatatgataccttccaatataaagctttttgataatgtaagcactaagtagaccaccctgtaaggcaatgaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47136002 |
gaaacggcaaaaacagttctggaattccaatatgataccttccaatataaagctttttgataatgtaagcactaagtagaccaccctgtaaggcaatgaa |
47136101 |
T |
 |
| Q |
107 |
gacacatcacaccagagccacatgcacatttgtacttgagagaatcaaagagagcaagacagttaccaaaactcaaagcatagtgcttgctataaacaga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
47136102 |
gacacatcacaccagagccacatgcacatttgtacttgagagaatcaaagagagcaagacagttaccaaaactccaagcatggtgcttgctataaacaga |
47136201 |
T |
 |
| Q |
207 |
tacaagaagtagccaaaaa |
225 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
47136202 |
tacaagaagttgccaaaaa |
47136220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University