View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3913_low_52 (Length: 224)
Name: NF3913_low_52
Description: NF3913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3913_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 209
Target Start/End: Complemental strand, 19213994 - 19213802
Alignment:
| Q |
17 |
actttttgaggtagaagaatgttaaagagtgattggtgttgtttgtatttgcagggctaatgatatatgtagggagtcaaagaggcagattatcaatgct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19213994 |
actttttgaggtagaagaatgttaaagagtgattggtgttgtttgtatttgcagggctaatgatatatgtagggagtcaaagaggcagattatcaatgct |
19213895 |
T |
 |
| Q |
117 |
gaagatgtgttcaaagctcttgaagaaaccgagtttgctgagtttgttggccctctaaaagattctcttgaaggtcactttcactttcctatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19213894 |
gaagatgtgttcaaagctcttgaagaaaccgagtttgctgagtttgttggccctctaaaagattctcttgaaggtcactttcactttcctatg |
19213802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University