View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3913_low_53 (Length: 221)
Name: NF3913_low_53
Description: NF3913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3913_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 203
Target Start/End: Complemental strand, 32096034 - 32095848
Alignment:
| Q |
22 |
tttgccaaaaccagaatgattatgtcaatctcactgtaaatctaaacaggtaatgattatgattttggcatct-----acattggcttaatatgtacata |
116 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32096034 |
tttgccaaaatcagaatgattatgtcaatctcactgtgaatctaaacaggtaatgattatgattttggcatctcgtatacattggcttaatatgtacata |
32095935 |
T |
 |
| Q |
117 |
tatatcatctcaagccatgaccctaggaagtgaagtctagtagtaattaataaacaacatttggaagatatggattctagatcatct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32095934 |
tatatcatctcaagccatgaccctaggaagtgaagtctagtagtaattaataaacaacatttggaagatatggattctatatcatct |
32095848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University