View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3913_low_53 (Length: 221)

Name: NF3913_low_53
Description: NF3913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3913_low_53
NF3913_low_53
[»] chr1 (1 HSPs)
chr1 (22-203)||(32095848-32096034)


Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 203
Target Start/End: Complemental strand, 32096034 - 32095848
Alignment:
22 tttgccaaaaccagaatgattatgtcaatctcactgtaaatctaaacaggtaatgattatgattttggcatct-----acattggcttaatatgtacata 116  Q
    |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||    
32096034 tttgccaaaatcagaatgattatgtcaatctcactgtgaatctaaacaggtaatgattatgattttggcatctcgtatacattggcttaatatgtacata 32095935  T
117 tatatcatctcaagccatgaccctaggaagtgaagtctagtagtaattaataaacaacatttggaagatatggattctagatcatct 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
32095934 tatatcatctcaagccatgaccctaggaagtgaagtctagtagtaattaataaacaacatttggaagatatggattctatatcatct 32095848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University