View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3914_high_13 (Length: 226)
Name: NF3914_high_13
Description: NF3914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3914_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 51297565 - 51297770
Alignment:
| Q |
1 |
gaaaaacagaataaaaccaaaaagaaaggacaattgtagtgatggaataaatttatatggttattttggagtgacaaaacaaatgttcagtac-tctata |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
51297565 |
gaaaaacagaataaaaccaaaaagaaaggacaattttagtgatggaataaatttatatggttattttggagtgacaaaacaaatgttgagtacttctata |
51297664 |
T |
 |
| Q |
100 |
ctatttnnnnnnnnnnnnnnnnnnncgacagaaatacattcccatactatcaaatagaattatttttattgttgtgttcactccctttttaagagactgt |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51297665 |
ctattt---ttgttgttgttgttgtcgacagaaatacattcccatactatcaaatagaattattttcattgttgtgttcactccctttttaagagactgt |
51297761 |
T |
 |
| Q |
200 |
tggcacatg |
208 |
Q |
| |
|
||||||||| |
|
|
| T |
51297762 |
tggcacatg |
51297770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 79
Target Start/End: Complemental strand, 2484811 - 2484738
Alignment:
| Q |
8 |
agaataaaaccaaaaagaaaggacaattgtagtgatggaataa--atttatatggttattttggagtgacaaaa |
79 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||| |||||| ||||| ||||||||||||||| |||||| |
|
|
| T |
2484811 |
agaataaaacgtaaaagaaaggacaattatagtgaatgaataactttttatttggttattttggagtaacaaaa |
2484738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University