View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3914_high_4 (Length: 380)
Name: NF3914_high_4
Description: NF3914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3914_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 151 - 364
Target Start/End: Original strand, 41078597 - 41078809
Alignment:
| Q |
151 |
ggcagttcaaataaaatgacaatttatttttaacacaaaaactgctagtttaatttaactaaaaaatgcataatgaacgacatactaagaaaactaaaaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41078597 |
ggcagttcaaataaaatgacaatttatttttaacacaaaaactgcta-tttaatttaactaaaaaatgcataatgaacgacatactaagaaaactaaaaa |
41078695 |
T |
 |
| Q |
251 |
taaacaattcatgtggtgcctatgtcatgatggggaacacaataaaaagttattcaatgtgatcctttttgtgcgttatgtcctgaaagttcttggcacc |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41078696 |
taaacaattcatgtggtgcctatgtcatgatggggaacacaataaaaaggtattcaatgtgatcctttttgtgcgttatgtcctgaaagttcttggcacc |
41078795 |
T |
 |
| Q |
351 |
tagtagtatttttt |
364 |
Q |
| |
|
||||| | |||||| |
|
|
| T |
41078796 |
tagtattttttttt |
41078809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 11 - 118
Target Start/End: Original strand, 41078457 - 41078564
Alignment:
| Q |
11 |
gaagcaaagggtggtggtggtggcagtgtgactgagagaggagaaggtgagtatgtgagtacctaaaattagagttacagttcttagtgaggcgagtaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41078457 |
gaagcaaagggtggtggtggtggcagtgtgactgagagaggagaaggtgagtatgtgagtacctaaaattagagttacagttcttagtggggcgagtaaa |
41078556 |
T |
 |
| Q |
111 |
tttggcca |
118 |
Q |
| |
|
|||||||| |
|
|
| T |
41078557 |
tttggcca |
41078564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University