View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3914_low_12 (Length: 244)
Name: NF3914_low_12
Description: NF3914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3914_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 41079230 - 41079446
Alignment:
| Q |
17 |
tcgtcttggtcggataactttcgcacaatcttccaggtttttatgttatccattatcactgccttggttatagatttcatctacttgacaatccggatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41079230 |
tcgtcttggtcggataactttcgcacaatcttccaggtttttatgttatccattatcactgccttggttatagatttcatctacttgacaattcggatgt |
41079329 |
T |
 |
| Q |
117 |
gctacgaaatcttcatcaagtggtggcgttcgccctcaccggcgacagtggcgc-----acgggtaatgaggtcgagatggttccagtttgaagacatca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41079330 |
gctacgaaatcttcatcaagtggtggcgttcatcctcaccggcgacagtggcgcctgagacgggtaatgaggtcgagatggttccagtttgaagacatca |
41079429 |
T |
 |
| Q |
212 |
tccaggtaggttgtttc |
228 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41079430 |
tccaggtaggttgtttc |
41079446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University