View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3914_low_13 (Length: 243)

Name: NF3914_low_13
Description: NF3914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3914_low_13
NF3914_low_13
[»] chr3 (1 HSPs)
chr3 (44-225)||(40728456-40728637)


Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 44 - 225
Target Start/End: Complemental strand, 40728637 - 40728456
Alignment:
44 gtgtataatactttggcaatactagttttcattatttgggcactttcaattaattataagagtgggggtgttgcaattttagttattattggaatcttat 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40728637 gtgtataatactttggcaatactagttttcattatttgggcactttcaattaattataagagtgggggtgttgcaattttagttattattggaatcttat 40728538  T
144 actttgttgggattttgtatcttacaataatttggcaattagctagtgttgttaccgttttagaagactcttatggatttaa 225  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
40728537 actttgttgggattttgtatcttacaataatttggcaattagctagtgttgttaccgttttagaagactcatatggatttaa 40728456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University