View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3914_low_15 (Length: 202)

Name: NF3914_low_15
Description: NF3914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3914_low_15
NF3914_low_15
[»] chr7 (8 HSPs)
chr7 (19-187)||(22884801-22884956)
chr7 (19-187)||(22803438-22803606)
chr7 (19-187)||(22869936-22870104)
chr7 (19-187)||(22887402-22887569)
chr7 (53-187)||(22829175-22829309)
chr7 (19-78)||(22807206-22807265)
chr7 (145-183)||(22874163-22874201)
chr7 (121-158)||(22807278-22807315)
[»] chr1 (1 HSPs)
chr1 (131-186)||(21152387-21152442)


Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 8)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 22884801 - 22884956
Alignment:
19 atatgggcatatgcagaattactgaagtgtccacgaaaatagaaccagtgcaggagaaaaaataaagagcttctccgagtctttagcacaaatagaattt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||| ||||    
22884801 atatgggcatatgcagaattactgaagtgtccacgaaaatagaaccagtgcaggagaaaaaataaagagc------------ttagcacaaataggattt 22884888  T
119 cggaagttatttagtggttgccttattgcatttgaaggttttgcagattatttctttgtttaccctttg 187  Q
      |||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||||||||    
22884889 ttgaagttatttagtggttgccttatcgcatttgaagg-tttgcaggttatttctttgtttaccctttg 22884956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 22803438 - 22803606
Alignment:
19 atatgggcatatgcagaattactgaagtgtccacgaaaatagaaccagtgcaggagaaaaaataaagagcttctccgagtctttagcacaaatagaattt 118  Q
    ||||| |||||| | |||||| ||||||||||| ||||||||||| | || ||||||||| || |||||||| ||||||||||||||||||| |||||||    
22803438 atatgtgcatatactgaattattgaagtgtccaagaaaatagaacgactgaaggagaaaagatgaagagcttgtccgagtctttagcacaaacagaattt 22803537  T
119 cggaagttatttagtggttgccttattgcatttgaaggttttgcagattatttctttgtttaccctttg 187  Q
    | |||| |||||||||||||  |||||||||||||| ||||| ||| ||||||||||||||||||||||    
22803538 ctgaagatatttagtggttggtttattgcatttgaaagtttttcaggttatttctttgtttaccctttg 22803606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 22869936 - 22870104
Alignment:
19 atatgggcatatgcagaattactgaagtgtccacgaaaatagaaccagtgcaggagaaaaaataaagagcttctccgagtctttagcacaaatagaattt 118  Q
    ||||| |||||| | |||||| ||||||||||| ||||||||||| | || ||||||||| || |||||||| ||||||||||||||||||| |||||||    
22869936 atatgtgcatatactgaattattgaagtgtccaagaaaatagaacgactgaaggagaaaagatgaagagcttgtccgagtctttagcacaaacagaattt 22870035  T
119 cggaagttatttagtggttgccttattgcatttgaaggttttgcagattatttctttgtttaccctttg 187  Q
    | |||| |||||||||||||  |||||||||||||| ||||| ||| ||||||||||||||||||||||    
22870036 ctgaagatatttagtggttggtttattgcatttgaaagtttttcaggttatttctttgtttaccctttg 22870104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 22887402 - 22887569
Alignment:
19 atatgggcatatgcagaattactgaagtgtccacgaaaatagaaccagtgcaggagaaaaaataaagagcttctccgagtctttagcacaaatagaattt 118  Q
    ||||| |||||||||||| |||||||||||  | |||||| |||| |||  ||||||||| || |||||||| |  |||||||||| ||||||| |||||    
22887402 atatgtgcatatgcagaactactgaagtgttgaagaaaatcgaacgagtaaaggagaaaagatgaagagcttgtttgagtctttagaacaaatataattt 22887501  T
119 cggaagttatttagtggttgccttattgcatttgaaggttttgcagattatttctttgtttaccctttg 187  Q
    | |||||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||    
22887502 ctgaagttatttagtggttgccttattgcatttg-aggttttgcaggttatttcttagtttaccctttg 22887569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 53 - 187
Target Start/End: Original strand, 22829175 - 22829309
Alignment:
53 gaaaatagaaccagtgcaggagaaaaaataaagagcttctccgagtctttagcacaaatagaatttcggaagttatttagtggttgccttattgcatttg 152  Q
    |||| |||||| |||| ||||||||| || |||||||| || |||||||||||||||| | |||||| |||||||||||||| |||  ||||||||||||    
22829175 gaaattagaacgagtggaggagaaaagatgaagagcttgtctgagtctttagcacaaacataatttctgaagttatttagtgattggtttattgcatttg 22829274  T
153 aaggttttgcagattatttctttgtttaccctttg 187  Q
    |||||||| ||| ||||||||||| ||||||||||    
22829275 aaggttttacaggttatttctttgattaccctttg 22829309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 22807206 - 22807265
Alignment:
19 atatgggcatatgcagaattactgaagtgtccacgaaaatagaaccagtgcaggagaaaa 78  Q
    ||||| |||||||||||||||||||||| ||||  |||||| ||| |||| |||||||||    
22807206 atatgtgcatatgcagaattactgaagtatccaataaaataaaacgagtggaggagaaaa 22807265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 183
Target Start/End: Original strand, 22874163 - 22874201
Alignment:
145 tgcatttgaaggttttgcagattatttctttgtttaccc 183  Q
    |||||||||||||||| ||| ||||||||||||||||||    
22874163 tgcatttgaaggtttttcaggttatttctttgtttaccc 22874201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 121 - 158
Target Start/End: Original strand, 22807278 - 22807315
Alignment:
121 gaagttatttagtggttgccttattgcatttgaaggtt 158  Q
    |||||||| ||||||||| |||||||||||||||||||    
22807278 gaagttatctagtggttggcttattgcatttgaaggtt 22807315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 131 - 186
Target Start/End: Complemental strand, 21152442 - 21152387
Alignment:
131 agtggttgccttattgcatttgaaggttttgcagattatttctttgtttacccttt 186  Q
    |||||||||||||||||||||||||||||||||| |||||| |||| |||||||||    
21152442 agtggttgccttattgcatttgaaggttttgcaggttatttatttggttacccttt 21152387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University