View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3914_low_4 (Length: 385)
Name: NF3914_low_4
Description: NF3914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3914_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 312; Significance: 1e-176; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 18 - 337
Target Start/End: Original strand, 10036579 - 10036898
Alignment:
| Q |
18 |
attatttcattaaaaataagataatcaaacatgcaagtgtttcgattcaattttggctttgacttctttacctcaggtcctcacttcaatccactcaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10036579 |
attatttcattaaaaataagataatcaaacatgcaagtgtttcgattcaattttggctttgacttctttacctcaggtcctcacttcaatccactcaaga |
10036678 |
T |
|
| Q |
118 |
aggatcacggagctcctaccgatgatgagcgacatgccggtgatttgggtaacattgttgcaggccctgatggtattacattctttcttcttcgtctttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10036679 |
aggatcacggagctcctaccgatgatgagcgacatgccggtgatttgggtaacattgttgcaggccctgatggtattacattctttcttcttcgtctttt |
10036778 |
T |
|
| Q |
218 |
ttatatatttattttgagattttaacaatgtataagttgtcccccgggaaatctccttgagagttttctgttttgcaggagttgctgagatttctatcag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10036779 |
ttatatatttattttgagattttaacaatgtataagttgtcccctgggaaatctccttgagagttttctgttttgcaggagttgctgagatttctatcag |
10036878 |
T |
|
| Q |
318 |
agatggaaaggtacagaact |
337 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
10036879 |
agatggaaaggtaaagaact |
10036898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 335 - 375
Target Start/End: Original strand, 10037076 - 10037116
Alignment:
| Q |
335 |
actatataacatagcgaaatttgaacaatcgctattattct |
375 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10037076 |
actatataacataacgaaatttgaacaatcgctattattct |
10037116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University