View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3914_low_9 (Length: 307)
Name: NF3914_low_9
Description: NF3914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3914_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 11 - 166
Target Start/End: Complemental strand, 30957343 - 30957188
Alignment:
| Q |
11 |
cagagacaaatggtggaattagagaagcagaggatgcagtttgtgaaggatttggagtatcagagaatgcagttatacatggaaacgcaggttcagcttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30957343 |
cagagacaaatggtggaattagagaagcagaggatgcagtttgtgaaggatttggagtatcagagaatgcagttatacatggaaacgcaggttcagcttc |
30957244 |
T |
 |
| Q |
111 |
agaaaatcaaacgcactaaacgtgcttctggttccggtgagcttaacctgtttcaa |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30957243 |
agaaaatcaaacgcactaaacgtgcttctggttccggtgagcttaacctgtttcaa |
30957188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 239 - 290
Target Start/End: Complemental strand, 30957117 - 30957066
Alignment:
| Q |
239 |
gcttgattgcttatgcttaatgattattaggagcttgttaatcacattaatg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30957117 |
gcttgattgcttatgcttaatgattattaggagcttgttaatcacattaatg |
30957066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 32 - 102
Target Start/End: Complemental strand, 7893071 - 7893001
Alignment:
| Q |
32 |
gagaagcagaggatgcagtttgtgaaggatttggagtatcagagaatgcagttatacatggaaacgcaggt |
102 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||| |||||||||||||| | |||| |||| ||||| |
|
|
| T |
7893071 |
gagaagcagaggatgaagtttgctaaggatttggagttgcagagaatgcagtttttcatgaaaactcaggt |
7893001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University