View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3915_high_6 (Length: 271)
Name: NF3915_high_6
Description: NF3915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3915_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 256
Target Start/End: Complemental strand, 39483540 - 39483295
Alignment:
| Q |
11 |
cagagaaatcaagattatcacttttcctaacaacttcaagaatattcacccagaagaacatcactttgacacttatacccctgagatcggtaagtctgtt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39483540 |
cagagaaatcaagattatcacttttcctaacaacttcaagaatattcacccagaagaacatcactttgacacttatacccctgagatcggtaagtctgtt |
39483441 |
T |
|
| Q |
111 |
ttccgttattttaccggtgatcgttgatttgtaactcaattgatacgaaccttgtaacgaaaaactgcacgaacggtttagatcagcgcggaaatttcca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39483440 |
ttccgttattttaccggtgatcgttgatttgtaactcaattgatacgaaccttgtaacgaaaaactgcacgaacgatttagatcagcgcggaaatttcca |
39483341 |
T |
|
| Q |
211 |
cttgatttgtctaattcgtaattggttactcctattgggagaattc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39483340 |
cttgatttgtctaattcgtaattggttactcctattgggagaattc |
39483295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University