View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3915_low_4 (Length: 307)
Name: NF3915_low_4
Description: NF3915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3915_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 16 - 291
Target Start/End: Complemental strand, 4648167 - 4647896
Alignment:
| Q |
16 |
aaatttattcctgctaatatatatttctctttgatttactatttaatgataattctatatttccaacacttctattttggttcggggtagatggagggga |
115 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4648167 |
aaatttattcctgctaatat----ttctctttgatttactatttaatgataattctatatttccaacacttctattttggttcggggtagatggagggga |
4648072 |
T |
|
| Q |
116 |
gaggagaggaggaaatgttgttaatcatatgtattggttcaattttgaagagggaatacgtgggaaacaaaatctctcacaaacttaatatttgctcccc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
4648071 |
gaggagaggaggaaatgttgttaatcatatgtgttggttcaattttgaagagggaataagtgggacacaaaatctctcacaaactcaatatttgctcccc |
4647972 |
T |
|
| Q |
216 |
aaaattgggtcttttttaatgggaggggaggtaagctattacaattttagtgatgttgattgagttaaccttaatc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4647971 |
gaaattgggtcttttttaatgggaggggaggtaagctattacaattttagtgatgttgattgagttaaccttaatc |
4647896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 69
Target Start/End: Original strand, 36795091 - 36795124
Alignment:
| Q |
36 |
atatttctctttgatttactatttaatgataatt |
69 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
36795091 |
atatttctctttgatttactacttaatgataatt |
36795124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University