View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3915_low_8 (Length: 259)
Name: NF3915_low_8
Description: NF3915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3915_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 16 - 252
Target Start/End: Complemental strand, 3863101 - 3862865
Alignment:
| Q |
16 |
cacctattagaagaacctgaagaatgcattctaacttttgtaaggttggataagatgctatattcattgattctttccatattccttttaatcatgaaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3863101 |
cacctattagaagaacctgaagaatgcattctaacttttgtaaggttggataagatgctatattcattgattctttccatattccttttaatcatgaaac |
3863002 |
T |
 |
| Q |
116 |
tctcagaaattcaaagtatgtagtttgatgcttttttactctgttaacattcatatcaaggaattggacctataaaatttttcttgagttttctgactta |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
3863001 |
tctcagaaattcaaagtatttagtttgatgcttttttactctgttaacattcatatcaaggaattgaacctataaaaaatttcttgagttttctgactta |
3862902 |
T |
 |
| Q |
216 |
atcgagcctgttgagttaggcgagaccacctttgcta |
252 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
3862901 |
atcgagcctattgagttaggcgagaccaccttggcta |
3862865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University