View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3916_low_4 (Length: 240)
Name: NF3916_low_4
Description: NF3916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3916_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 108 - 190
Target Start/End: Original strand, 38138677 - 38138759
Alignment:
| Q |
108 |
aacaaaatagctcatcttttatttcggtattcatctccatatcttctttttctagacaatttacacaaagttaatggctatat |
190 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38138677 |
aacaaaatagcttatcttttatttcggtattcatctccatatcttctttttctagacaatttacacaaagttaacggctatat |
38138759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 172
Target Start/End: Complemental strand, 30224310 - 30224241
Alignment:
| Q |
103 |
ttctcaacaaaatagctcatcttttatttcggtattcatctccatatcttctttttctagacaatttaca |
172 |
Q |
| |
|
||||||||||| || || |||||||||||| | ||||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
30224310 |
ttctcaacaaattaactaatcttttatttccgcattcatctcaatatcttcgttttctaggcaatttaca |
30224241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 240
Target Start/End: Original strand, 38138830 - 38138873
Alignment:
| Q |
197 |
atccgtgtaacgcgcgggctttatctagtaatataataataatg |
240 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
38138830 |
atccgtgtaaagtgcgggcttcatctagtaatataataataatg |
38138873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University