View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3917_high_10 (Length: 245)
Name: NF3917_high_10
Description: NF3917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3917_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 16919926 - 16919686
Alignment:
| Q |
1 |
atcttttaaggatgcttataagtttaaagacaccccttcccagtctattcaatgggccaaaactatttggtctccaaacattccccctatcaaaatctct |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
16919926 |
atcttttaaggatgcttatgagtttaaagacaccccttcccagtctattcaatgggccaaaactatctggtctccaaacattccccc-atcaaaatctct |
16919828 |
T |
|
| Q |
101 |
gcttgcatggagattaatgaacgataaaatcccagttgatgagaacctaaaagatagaggatgccatttgccttcagtttgcagtctttgcatggtttcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16919827 |
gcttgcatggagattaatgaacgataaaatcccagttgatgagaacctaaaagatagaggatgtcatttgccttcagtttgcagtctttgcatggtttct |
16919728 |
T |
|
| Q |
201 |
gaggaaacgatttttcaccttttctttgattgtccctatgct |
242 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| |||||| |
|
|
| T |
16919727 |
gaggaaacggcttttcacctattctttgattgtccttatgct |
16919686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University