View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3917_low_11 (Length: 256)
Name: NF3917_low_11
Description: NF3917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3917_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 16 - 248
Target Start/End: Original strand, 11326772 - 11327004
Alignment:
| Q |
16 |
cttcttccaaatgatataaacatttatgtaactactgcttcgaataaatcagagaatagtttcggattttactgcccaaactcatatgttcctccaccac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11326772 |
cttcttccaaatgatataaacatttatgtaactactgcttcgaataaatcagagaatagttacggattttactgcccaaactcatatcttcctccaccac |
11326871 |
T |
 |
| Q |
116 |
ctgagtatgatatttgtttgggagatctctacagcatttcatggatggaagacgggtacnnnnnnnnnnnnnnnnnagggggaacgaacacaggtatttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
11326872 |
ctgagtatgatatttgtttgggagatctctacagcatttcatggatggaagacaggtactttttttattgttttttagggggaacgaacacaggtatttt |
11326971 |
T |
 |
| Q |
216 |
tatttgttaattagataatatggtctctgtgtt |
248 |
Q |
| |
|
|| ||||||||||||||||||||| || ||||| |
|
|
| T |
11326972 |
taattgttaattagataatatggtttcagtgtt |
11327004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University