View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3917_low_15 (Length: 237)
Name: NF3917_low_15
Description: NF3917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3917_low_15 |
 |  |
|
| [»] scaffold0401 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 16920047 - 16920267
Alignment:
| Q |
1 |
ttccagcaattgtcttgaatgtaatcactgactaaaatactttgatcaacgacttcattagtcnnnnnnngattgaaaggttgaccacaccattgatcag |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
16920047 |
ttccagcaattgtcatgaatgtaatcactgaccaaaatactttgatcaacaacttcattagtcaaaaaaagattgagaggttgaccacaccattgatcag |
16920146 |
T |
 |
| Q |
101 |
accaaaaatgaattttgttaccatcaccaagaagccaggtggaatgctccataatcacattgtattcattttttatgctagaccagattgatgaagagat |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16920147 |
accaaaaatgaattttgttgccatcaccaagaagccaggtggaatgctccataatcacattgtattcattttttatgctagaccagattgatgaagagat |
16920246 |
T |
 |
| Q |
201 |
gtgatgagaaataattcttct |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
16920247 |
gtgatgagaaataattcttct |
16920267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0401 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0401
Description:
Target: scaffold0401; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 85 - 203
Target Start/End: Original strand, 13251 - 13369
Alignment:
| Q |
85 |
ccacaccattgatcagaccaaaaatgaattttgttaccatcaccaagaagccaggtggaatgctccataatcacattgtattcattttttatgctagacc |
184 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| ||||||||||||||||||| | ||||||||| || ||| | || ||| |||| |||||||||| |
|
|
| T |
13251 |
ccacaccatttatcagaccaaaaatgaatattgtgaccatcaccaagaagccagcaagcatgctccatcatgacactatactcacttttgatgctagacc |
13350 |
T |
 |
| Q |
185 |
agattgatgaagagatgtg |
203 |
Q |
| |
|
| ||||||||||| ||||| |
|
|
| T |
13351 |
aaattgatgaagatatgtg |
13369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University