View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3917_low_17 (Length: 231)
Name: NF3917_low_17
Description: NF3917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3917_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 5 - 214
Target Start/End: Original strand, 48051665 - 48051874
Alignment:
| Q |
5 |
aggtttatcaatcttgttacttagaaccagcagtggatgtgtccactcttttaactcttccaccccagccaccaagtcaaccttatcactcccatgtcat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48051665 |
aggtttatcaatcttgttacttagaaccagcagtggatgtgtccactcttttaactcttccaccccagccaccaagtcaaccttataactcccatgtcat |
48051764 |
T |
|
| Q |
105 |
gggatgataactgtactttgtgatacctggccatatagataatcaaaatgaaattgattctatttgtggtgcagtgcagattgtgacatgccatttggtg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48051765 |
gggatgataactgtactttgtgatacctggccatatagataatcaaaatgaaattgattctatttgtggtgcagtgcagattgtgacatgccatttggtg |
48051864 |
T |
|
| Q |
205 |
acgtgccatc |
214 |
Q |
| |
|
|||||||||| |
|
|
| T |
48051865 |
acgtgccatc |
48051874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 54 - 106
Target Start/End: Original strand, 48043830 - 48043882
Alignment:
| Q |
54 |
tttaactcttccaccccagccaccaagtcaaccttatcactcccatgtcatgg |
106 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
48043830 |
tttaactcttccaccctagccaccaagtcaaccttataactcccaagtcatgg |
48043882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 214
Target Start/End: Original strand, 48044144 - 48044179
Alignment:
| Q |
179 |
tgcagattgtgacatgccatttggtgacgtgccatc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48044144 |
tgcagattgtgacatgccatttggtgacgtgccatc |
48044179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University