View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_high_110 (Length: 309)
Name: NF3918_high_110
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_high_110 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 162 - 266
Target Start/End: Complemental strand, 10974243 - 10974139
Alignment:
| Q |
162 |
aaatttattgttccattgttagagaatcacatgtgtatgaatcagttttctttcacaatatttaagtaaaagatgaaggagaaaggacaattagtcatga |
261 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10974243 |
aaattgattgttccattgttagagaatcacatgtttatgaatcagttttctttcacaatatttaaataaaagatgaaggagaaaggacaattagtcatga |
10974144 |
T |
|
| Q |
262 |
tatat |
266 |
Q |
| |
|
||||| |
|
|
| T |
10974143 |
tatat |
10974139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 93
Target Start/End: Complemental strand, 10974585 - 10974510
Alignment:
| Q |
18 |
ctttttatatattcgtccgcttatcatcaccgccgtccaccattgccgctgtttctgcaatttctatcttttgtat |
93 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
10974585 |
ctttttttatattcgtccgcttattatcaccgccgtccaccattgccgctgtttctacaatttctatcttctgtat |
10974510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 85 - 128
Target Start/End: Complemental strand, 10974323 - 10974281
Alignment:
| Q |
85 |
cttttgtatactgctttttccgttattcttcaatacggtgttca |
128 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
10974323 |
cttttgtatactgctttt-ccgttactcttcaatacggtgttca |
10974281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University