View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_high_111 (Length: 308)
Name: NF3918_high_111
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_high_111 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 20 - 308
Target Start/End: Complemental strand, 15245125 - 15244837
Alignment:
| Q |
20 |
tggtgaaattgaatgtttcctttttgcatcttcccaccatggacggtaaaccaaggtatttaacgatagccaaaattgcttgcacaactaaaatattagc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15245125 |
tggtgaaattgaatgtttcctttttgcatcttcctaccatggacggtaagccaaggtatttaacgatagccaaaattgcttgcgcaactaaaatattagt |
15245026 |
T |
 |
| Q |
120 |
gattgaattttgcatccgttgagggacattttgactttggaaggttggtcgcttataaataatagtttcattgtgacatatcttggctctgtcttaagcc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15245025 |
gattgaattttgcatccgttgagggacattttgactttggaaggttggtcgcttataaataatagtttcattgtgacatatcttggctctgtcttaagcc |
15244926 |
T |
 |
| Q |
220 |
tctcttaggaatgattgggtcaatcatctcatttagggtcgtttctatgatattggaggctcgactctgataataaagatagacccttg |
308 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15244925 |
tctcttaggaatgactgggtcaatcatctcattcagggtcgttcctatgatattggaggctcgactctgataataaagatagacccttg |
15244837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 254 - 294
Target Start/End: Complemental strand, 1327743 - 1327703
Alignment:
| Q |
254 |
agggtcgtttctatgatattggaggctcgactctgataata |
294 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
1327743 |
agggtcgtttttatgaaattggaggctcgactctcataata |
1327703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University