View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3918_high_140 (Length: 268)

Name: NF3918_high_140
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3918_high_140
NF3918_high_140
[»] chr1 (2 HSPs)
chr1 (11-132)||(3734391-3734512)
chr1 (179-252)||(3734275-3734348)
[»] chr3 (1 HSPs)
chr3 (23-98)||(48289018-48289093)


Alignment Details
Target: chr1 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 11 - 132
Target Start/End: Complemental strand, 3734512 - 3734391
Alignment:
11 caaaggcactgattgaaatacttgatgatgggtacagatggaggaagtatggaaagaaaatggttaagaatagccctaatccaaggtatatgtattggaa 110  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
3734512 caaagtcactgattgaaatacttgatgatgggtacagatggaggaagtatggaaagaaaatggttaagaatagccctaatccaaggtatatatattggaa 3734413  T
111 taccatgaaattaattgataac 132  Q
    ||||||||||||||||||||||    
3734412 taccatgaaattaattgataac 3734391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 179 - 252
Target Start/End: Complemental strand, 3734348 - 3734275
Alignment:
179 gtgattgcaggaattattataggtgttcagtggaggggtgtcctgtnnnnnnnngagttgagagagataataat 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||    
3734348 gtgattgcaggaattattataggtgttcagtggaggggtgtcctgtaaaaaaaagagttgagagagataataat 3734275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 23 - 98
Target Start/End: Complemental strand, 48289093 - 48289018
Alignment:
23 ttgaaatacttgatgatgggtacagatggaggaagtatggaaagaaaatggttaagaatagccctaatccaaggta 98  Q
    ||||||| || |||||||||| ||||||||||||||| |||||||| ||||| || || ||||| |||||||||||    
48289093 ttgaaattctggatgatgggttcagatggaggaagtacggaaagaagatggtgaaaaacagccccaatccaaggta 48289018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University