View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_high_143 (Length: 265)
Name: NF3918_high_143
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_high_143 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 102 - 250
Target Start/End: Complemental strand, 25362648 - 25362500
Alignment:
| Q |
102 |
gagcaagtagggacacctcatacgatcgtaatgtttaacttctcgtaggtgtctcacgcttgtcgagacttacaagtattgaagttattagcgttatatt |
201 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25362648 |
gagcaagtagggacacttcatacgatcgtaatgtttaacttctcgtaggtgtctcacgcttgtcgagacttacaagtattgaagttattaacgttatatt |
25362549 |
T |
|
| Q |
202 |
ttatacatatttatatatacaacctcatatgtaatgttgatatgatagt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25362548 |
ttatacatatttatatatacaacctcataggtaatgttgatatgatagt |
25362500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University