View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_high_144 (Length: 264)
Name: NF3918_high_144
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_high_144 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 47126501 - 47126248
Alignment:
| Q |
1 |
cctctgattattctagggagggtggactcactggtaagggaattcccaacagcatatccatctgaaaccattctctttgaattcttgctatttatctaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47126501 |
cctctgattattctagggagggtggactcactggtaagggaattcccaacagcatatccatctgaaaccattctctttgaatttttgctatttatctaac |
47126402 |
T |
|
| Q |
101 |
caaagacttagctttggtatcgaataaactatgtatcaccgacactttagattgaag----gtttggtgtccgacacgatccaaacatatgtgggtacat |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47126401 |
caaagacttagctttggtgtcgaataaactatgtatcaccgacactttagattgaaggtgtgtttggtgttcgacacgatccaaacatatgtgggtacat |
47126302 |
T |
|
| Q |
197 |
tcaattatttca---tcttaaattattattggtgtcatcatgtaagtgtcgtgt |
247 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126301 |
tcaattatttcattttcttaaattattattggtgtcatcatgtaagtgtcgtgt |
47126248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University