View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_high_151 (Length: 260)
Name: NF3918_high_151
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_high_151 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 35500840 - 35501067
Alignment:
| Q |
13 |
atgttcaaatatcattt-tatgttttattttaatttaataggaaaaagaagactccagcctgcatgttaggtcccacgatcacatgctaataatgtcata |
111 |
Q |
| |
|
||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35500840 |
atgttcatatatcatttctctgttttattttaatttaataggaaaaagaagactccagcctgcatgttaggtcccacgatcacatgctaataatgtcata |
35500939 |
T |
|
| Q |
112 |
ataaaactgnnnnnnnnnnnnatataattatgcttagaagaatcagttactgaattttcccctctaaaaacttcagctgtttagaagaagtggggaattt |
211 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35500940 |
ataaaactgttttttt------tttaattatgcttagaagaatcagttactgaattttcccctctaaaaacttcagctgtttagaagaagtggggaattt |
35501033 |
T |
|
| Q |
212 |
gttatgcaaatatggtaaattaaggagttcagat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35501034 |
gttatgcaaatatggtaaattaaggagttcagat |
35501067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University