View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_high_156 (Length: 258)
Name: NF3918_high_156
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_high_156 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 7942718 - 7942472
Alignment:
| Q |
1 |
agaggaaatataagtataaggaattccttcagcttcaattgcccttctgatttttgctttttgcccaaaaaagctagctaccggctcaacggcatggtga |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7942718 |
agaggaaatataagtgtaaggaattccttcagcttcaattgcccttctgatttttgctttttgcccaaaaaagctagctaccggctcaacagcatggtga |
7942619 |
T |
|
| Q |
101 |
cggtcaacgtcgatcccgaattcagatgggagaaacctctgatgggaacaaaataataccaatttatatagctaattcaagtatattgctattttaattc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
7942618 |
cggtcaacgtcgatcccgaattcagatgggagaaacctctgataggaacaaaataacaccaatttatatagctaattcaagtacatagctattttaattc |
7942519 |
T |
|
| Q |
201 |
agtgaaaaataagaccaatttgtaccttgatgtttcctgcttccttt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7942518 |
agtgaaaaataagaccaatttgtaccttgatgtttcctgcttccttt |
7942472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University