View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_high_160 (Length: 252)
Name: NF3918_high_160
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_high_160 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 6198404 - 6198628
Alignment:
| Q |
19 |
actagaccataaattattgcatttgaattgatctaaccctcacaataatactttgcaccatatatacactctct--cccacttatatgtttttcttttcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6198404 |
actagaccataaattattgcatttgaattgatctaaccctcacaataatactttgcaccatatatacactctctcccccacttatatttttttcttttcc |
6198503 |
T |
 |
| Q |
117 |
tcaatgtttattaacttatgtctctcctaaccnnnnnnnnnnttgattgttttctgatttgaatcaagcaattattatggccataggtctatcaattttc |
216 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6198504 |
tcaatgtttattaacttatctctctcctaacc-aaaaaaaaattgattgttctcttatttgaatcaagcaattattatggccataggtctaacaattttc |
6198602 |
T |
 |
| Q |
217 |
ttctcaaattcttttgtaatcctttg |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6198603 |
ttctcaaattcttttgtaatcctttg |
6198628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 183 - 242
Target Start/End: Original strand, 22450556 - 22450615
Alignment:
| Q |
183 |
agcaattattatggccataggtctatcaattttcttctcaaattcttttgtaatcctttg |
242 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
22450556 |
agcaattattatggccataggtctcacaattttcttctgaaattcttttttaatcctttg |
22450615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University