View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_high_196 (Length: 237)
Name: NF3918_high_196
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_high_196 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 44 - 205
Target Start/End: Original strand, 41444294 - 41444455
Alignment:
| Q |
44 |
attcccaacttgtcccttttagttcgttctctatctaagtttaatttacaactatttctagatgcatatggaccatttgcatatgttcctccaaactctg |
143 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41444294 |
attcccaacttgtcccttttagttcattctctatctaagtttaatttacaactatttctagatgcatatggaccatttgcatatgttcctccaaactctg |
41444393 |
T |
|
| Q |
144 |
cttggtgtcatggacctattgagcataaccttcaactattatcataattcaacagtaattgt |
205 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41444394 |
cttggtgtcatggacttattgagcagaaccttcaactattatcataattcaacagtaattgt |
41444455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University