View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_high_200 (Length: 237)
Name: NF3918_high_200
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_high_200 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 3200188 - 3200408
Alignment:
| Q |
17 |
aataaggtataaggtcccatcaaaatccgaaagttgtccaaaggaagcaacattgtcatgtgaaatatccatatccattccatcatcaaaggttcacaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3200188 |
aataaggtataaggtcccatcaaaatctgaaagttgtccaagggaagcaacattgtcatgtgaaatatccatatccattccatcatcaaaggttcacaaa |
3200287 |
T |
 |
| Q |
117 |
aatttagatttaaattttatgagtcaaaagataccgaacttgaatttcagccgtctcatcttaatcaaataagtctcaaatacataaattcgttgatttc |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3200288 |
agtttagatttaaattttatgagtcaaaagataccgaacttgaatttcagccgtctaatcttaatcaaataagtctcaaatacgtaaattcgttgatttc |
3200387 |
T |
 |
| Q |
217 |
caactacagggagccggatcc |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3200388 |
caactacagggagccggatcc |
3200408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University