View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_high_213 (Length: 227)
Name: NF3918_high_213
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_high_213 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 3 - 227
Target Start/End: Complemental strand, 41445254 - 41445030
Alignment:
| Q |
3 |
gtgtgttcttatgggaagaaaaaggtggtgtgtaagattgaagattttgcctttgtttgattcaaaaccgtcaaagacaaaaatgtcaagtgtagccttg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41445254 |
gtgtgttcttatgggaagaaaaaggtggtgtgtaagattgaagattttgcctttgtttgattcaaaaccgtcaaagacaaaaatgtcaagtgtagccttg |
41445155 |
T |
|
| Q |
103 |
cctttattcttttcgcactttctctctccttctcaccatttgctttcggttctaaaataaaatgctttgtctagagctttagatcatttatagatcaata |
202 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41445154 |
cctttattcttttggtactttctctctccttctcaccatttgctttcggttctaaaataaaatgctttgtctagagctttagatcatttatagatcaata |
41445055 |
T |
|
| Q |
203 |
gcttcctcctatggttaagtggaat |
227 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41445054 |
gcttcctcctatggttaagtggaat |
41445030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University