View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3918_high_83 (Length: 362)

Name: NF3918_high_83
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3918_high_83
NF3918_high_83
[»] chr8 (2 HSPs)
chr8 (19-207)||(39044865-39045053)
chr8 (266-353)||(39045112-39045199)
[»] chr7 (1 HSPs)
chr7 (112-187)||(40022292-40022367)


Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 207
Target Start/End: Original strand, 39044865 - 39045053
Alignment:
19 gagaggttgatggccgattggatgagttggagagcggtgggatttggagggagattggcgagtgatgattcgcattgttgtgggaatcgggttgctttgc 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39044865 gagaggttgatggccgattggatgagttggagagcggtgggatttggagggagattggcgagtgatgattcgcattgttgtgggaatcgggttgctttgc 39044964  T
119 aggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggtgattgtggttgtgatggtgagtggcg 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39044965 aggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggtgattgtggttgtgatggtgagtggcg 39045053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 266 - 353
Target Start/End: Original strand, 39045112 - 39045199
Alignment:
266 tggttattgcgagtttaatgggtttgttcatggttgtgattttattttatacagcaaatgtgtatgtttggtcgtaatggagtattat 353  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
39045112 tggttattgcgagtttaatgggtttattcatggttgtgattttattttatacagcaactgtgtatgtttggtcgtaatggagtattat 39045199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 112 - 187
Target Start/End: Original strand, 40022292 - 40022367
Alignment:
112 gctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggtgattgt 187  Q
    ||||||||||||||||| ||||| ||| |||| |||||| |||||||||| || |||||  || ||||||| ||||    
40022292 gctttgcaggcttgttgaatctccgacgcggccgtgggataaacggagggagaaggagtgcgtgggtggtggttgt 40022367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University