View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_high_83 (Length: 362)
Name: NF3918_high_83
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_high_83 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 207
Target Start/End: Original strand, 39044865 - 39045053
Alignment:
| Q |
19 |
gagaggttgatggccgattggatgagttggagagcggtgggatttggagggagattggcgagtgatgattcgcattgttgtgggaatcgggttgctttgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39044865 |
gagaggttgatggccgattggatgagttggagagcggtgggatttggagggagattggcgagtgatgattcgcattgttgtgggaatcgggttgctttgc |
39044964 |
T |
 |
| Q |
119 |
aggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggtgattgtggttgtgatggtgagtggcg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39044965 |
aggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggtgattgtggttgtgatggtgagtggcg |
39045053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 266 - 353
Target Start/End: Original strand, 39045112 - 39045199
Alignment:
| Q |
266 |
tggttattgcgagtttaatgggtttgttcatggttgtgattttattttatacagcaaatgtgtatgtttggtcgtaatggagtattat |
353 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39045112 |
tggttattgcgagtttaatgggtttattcatggttgtgattttattttatacagcaactgtgtatgtttggtcgtaatggagtattat |
39045199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 112 - 187
Target Start/End: Original strand, 40022292 - 40022367
Alignment:
| Q |
112 |
gctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggtgattgt |
187 |
Q |
| |
|
||||||||||||||||| ||||| ||| |||| |||||| |||||||||| || ||||| || ||||||| |||| |
|
|
| T |
40022292 |
gctttgcaggcttgttgaatctccgacgcggccgtgggataaacggagggagaaggagtgcgtgggtggtggttgt |
40022367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University