View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_104 (Length: 325)
Name: NF3918_low_104
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_104 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 11 - 307
Target Start/End: Original strand, 7617187 - 7617483
Alignment:
| Q |
11 |
cacagatgatatcaagagaacaattttagaatatggtttcagcattgtcaaggaaaatattgttcaacttgatgagaccactgtgaaaagattttatgca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617187 |
cacagatgatatcaagagaacaattttagaatatggtttcagcattgtcaaggaaaagattgttcaacttgatgagaccactgtgaaaagattttatgca |
7617286 |
T |
 |
| Q |
111 |
gagcactcttcaaagaacttcttttccagccttgttaaatacatgaccaggtatcctatgattgcctcgactcttgttgcatgatggtggtatatactat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617287 |
gagcactcttcaaagaacttcttttccagccttgttaaatacatgaccaggtatcctatgattgcctcgactcttgttgcatgatggtggtatatactat |
7617386 |
T |
 |
| Q |
211 |
atcggtcttaatttgcggctgcagttacactatgaacctttatattgtggtaaaatgttggtaaatgtggccacaactgtggttgcggagacctcta |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7617387 |
atcggtcttaatttgcggctgcagttacactatgaacctttatattgtggtaaaatgttggtaaatgtggccacaactgcggttgcggagacctcta |
7617483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University