View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_108 (Length: 316)
Name: NF3918_low_108
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_108 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 13 - 304
Target Start/End: Original strand, 28001100 - 28001391
Alignment:
| Q |
13 |
tgaacattgaacattggtgctagcgattaaagacaaattgattaataataaactatgcatgcagtgtgtccattgatatttatctgatcctacagacacc |
112 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28001100 |
tgaacattgaatattggtgctagcgattaaagacaaattgattaataataaactatgcatgcagtgtgtccattgatatttatctgatcctacagacacc |
28001199 |
T |
 |
| Q |
113 |
aattaaatagtagtcacaaaatggcaaatgcagcaaaatacagagaacattgcaaattgaaattatcatgagcttgggacgcgagaggcccgctcgtgcg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28001200 |
aattaaatagtagtcacaaaatggcaaatgcagcaaaatacagagaacattgcaaattgaaattatcatgagcttgggacgcgagaggcccgctcgtgcg |
28001299 |
T |
 |
| Q |
213 |
gacaagccatcacgcttctaagtattgttgctagttgttgttactagtagaatattatgtcatttcagagccttttaccctaacaaataaat |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28001300 |
gacaagccatcacgcttctaagtattgttgctagttgttgttactagtagaatattatgtcatttcagagccttttaccctaacaaataaat |
28001391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University