View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_117 (Length: 304)
Name: NF3918_low_117
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_117 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 9 - 275
Target Start/End: Original strand, 29104135 - 29104401
Alignment:
| Q |
9 |
attatactgctgatcatgaaaatgattttacttttatggttggaaataattacaatcatgtgactgatcatatgaattccatgagatatattgatgacaa |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104135 |
attatgctgctgatcatgaaaatgattttacttttatggttggaaataattacaatcatgtgactgatcatatgaattccatgagatatattgatgacaa |
29104234 |
T |
 |
| Q |
109 |
agcatgggaagatccaaacacaagatcaattgaaattggggatcttgataatgaattcaaggctgaaaggatggtagagaatttaagatgggttggaatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104235 |
agcatgggaagatccaaacacaagatcaattgaaattggggatcttgataatgaattcaaggctgaaaggatggtagagaatttaagatgggttggaatg |
29104334 |
T |
 |
| Q |
209 |
tcaagcaatgatttagagaaggtatgctagctatattgctaatatttaaatttaaagtgccatctaa |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104335 |
tcaagcaatgatttagagaaggtatgctagctatattgctaatatttaaatttaaagtgccatctaa |
29104401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University