View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_123 (Length: 295)
Name: NF3918_low_123
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_123 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 7919509 - 7919287
Alignment:
| Q |
18 |
agtaatttgtaaatggttataatagctttgctttgcaatgaggagtaattgaacttacaaaactgattataatagccttataacttttatttgaaagttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7919509 |
agtaatttgtaaatggttataatagctttgc-----aatgaggagtaattgaacttacaaaaatgattataatagccttataaattttatttgaaagttt |
7919415 |
T |
|
| Q |
118 |
tatttagactaacaatactttctcttttgcgaaagaaaattaactcatcttttaatcaaatattactcaatacaagtacataatctcaaaataatggtta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7919414 |
tatttagactaacaatactttctcttttacgaaagaaaattaactcatcttttaatcaaatattactcaatacaagtacataatctcaaaataatggtta |
7919315 |
T |
|
| Q |
218 |
ctagtccaaggaatgaccgcatgtatga |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7919314 |
ctagtccaaggaatgaccgcatgtatga |
7919287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 247 - 275
Target Start/End: Original strand, 6138552 - 6138580
Alignment:
| Q |
247 |
taggggtgggaataggtcaggccgttcgt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6138552 |
taggggtgggaataggtcaggccgttcgt |
6138580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University