View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_126 (Length: 291)
Name: NF3918_low_126
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_126 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 75 - 281
Target Start/End: Original strand, 31344706 - 31344912
Alignment:
| Q |
75 |
gcttgtttctaggctaaattgcagccttaacaaaattacaacatgcaactcttctcaagtctttaattttcttgaactatctatatctattccttcagtt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31344706 |
gcttgtttctaggctaaattgcagccttaacaaaactacaacatgcaactcttctcaagtctttaattttcttgaactatctatatctattccttcagtt |
31344805 |
T |
 |
| Q |
175 |
ttctaattgtttgctgtagtatttaatttgaatatgacggcttaatttcgagatgctactttatttttcttttgtactatcttgcattgatgtttctata |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31344806 |
ttctaattgtttgctgtagtatttaatttgaatataacggcttaatttcgagatgctactttatttttcttttgtactatcttgcattgatgtttctata |
31344905 |
T |
 |
| Q |
275 |
atctgtg |
281 |
Q |
| |
|
|| |||| |
|
|
| T |
31344906 |
atatgtg |
31344912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 31344610 - 31344667
Alignment:
| Q |
18 |
aaaattgggaagagtatatgataggtgacatttttgttatgaatggaaagagaataag |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31344610 |
aaaattgggaagagtatatgataggtgacatttttgttatgaatggaaagagaataag |
31344667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University