View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_131 (Length: 282)
Name: NF3918_low_131
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_131 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 18 - 272
Target Start/End: Complemental strand, 38644988 - 38644734
Alignment:
| Q |
18 |
aacccttgtccatgagtcacatttattttgaaatgttgtccatttttgcattgttcaccatcataatcactagagaagaaatatgttgccccttctttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38644988 |
aacccttgtccatgagtcacatttattttgaaatgttgtccatttttgcattgttcaccatcataatcactagagaagaaatatgttgccccttctttca |
38644889 |
T |
|
| Q |
118 |
gtaaaggaactgccactgtgactggatgtatatcagtgttggacggatcaactgatgaccattggattgtgtccttgtcttgtgcatcatcataatcaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38644888 |
gtaaaggaactgccactgtgactggatgtatatcagtgttggacggatcaactgatgaccattggattgtgtccttgtcttgtgcatcatcataatcaca |
38644789 |
T |
|
| Q |
218 |
ctgtttgtatgtggtgaaattgtatgtttgaacaagagagtggttattgtctgtg |
272 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38644788 |
ttgtttgtatgtggtgaaattatatgtttgaacaagagagtggttattgtctgtg |
38644734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University